Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: A metagenomic ?-glucuronidase uncovers a core adaptive function of the human intestinal microbiome

doi: 10.1073/pnas.1000066107

Figure Lengend Snippet: Frequency of the unique β-glucuronidases and known β-glucuronidases in environmental and human gut metagenomes. Homologs of unique and known BG proteins were searched in NCBI metagenomic project datasets (Materials and Methods). The hit threshold was at least 50% similarity with 50% sequence coverage. Results of frequencies were expressed as hits per base pair to correct the different sizes of the metagenomic datasets investigated.

Article Snippet: The phyla and family assignments of H11G11-BG homologs from genomic databases were from the taxonomy reports automatically generated by NCBI (completed with the classification of R. gnavus ATCC 29149 using the Ribosomal Database Project).

Techniques: Sequencing

Journal: Immunity

Article Title: The xenobiotic transporter Mdr1 enforces T cell homeostasis in the presence of intestinal bile acids

doi: 10.1016/j.immuni.2017.11.012

Figure Lengend Snippet:

Article Snippet: Rag1 −/− Slc10a2 −/− This paper N/A Oligonucleotides Abcb1a ametrine 5′ CRISPR gRNA: 5′-GCUUCUCAAUGGUCAGUGUGCUGUUUUA GAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGCUUUU-3′ PNA Bio Inc. N/A ametrine Abcb1a 3′ CRISPR gRNA: 5′-GAAAAUACUUAACAUCUUACAUGUUUUA GAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGCUUUU-3′ PNA Bio Inc. N/A Universal 16S rDNA Forward: 5′-ACTCCTACGGGAGGCAGCAGT-3′ Integrated DNA Technologies Ayres et al., 2012 Universal 16S rDNA Reverse: 5′-ATTACCGCGGCTGCTGGC-3′ Integrated DNA Technologies Ayres et al., 2012 Abcb1a ametrine 5′ Genotype Primer: 5′-AGTTTAACGTGTCTGCAGCTGG-3′ Integrated DNA Technologies N/A Abcb1a ametrine 3′ Genotype Primer: 5′-AGCCTGCAGGATCTGTCTG-3′ Integrated DNA Technologies N/A Recombinant DNA Plasmid: LMPd-ametrine Chen et al., 2014 Dr. Matthew Pipkin Plasmid: LMPd-GFP This paper N/A Plasmid: pSTBlue-1 Novagen Cat# 70199 shRNAmir: Cd8a TransOMIC Technologies Cat# TLMSU1400-12525 shRNAmir: Abcb1a TransOMIC Technologies Cat# TLMSU1400-18671 shRNAmir: Abcb1b TransOMIC Technologies Cat# TLMSU1400-18669 pHaMDRwt Pastan et al., 1988 Addgene Plasmid #10957 LMPd.hMDR1-ametrine (containing wild-type human MDR1) (NCBI reference sequence {"type":"entrez-nucleotide","attrs":{"text":"NM_001348945.1","term_id":"1149123046"}} NM_001348945.1 ) This paper N/A LMPd. hMDR1-ametrine (containing transport-deficient human MDR1; Y401A, Y1044A) α This paper Kim et al., 2006 Software and Algorithms Graphpad Prism 7 GraphPad Software http://www.graphpad.com FlowJo (Version 9.9.4) TreeStar, Inc. http://www.flowjo.com GenePattern (Version 3.9.10) Broad Institute https://genepattern.broadinstitute.org nSolver Analysis Software (Version 1.1) Nanostring https://www.nanostring.com Other NanoString nCounter Sundrud_03 chip This paper https://www.nanostring.com NanoString nCounter Sundrud_04 chip This paper https://www.nanostring.com Open in a separate window

Techniques: Blocking Assay, Purification, Recombinant, Staining, Gene Expression, Magnetic Beads, Cell Isolation, SYBR Green Assay, Mutagenesis, Detection Assay, Fluorescence, Generated, CRISPR, Plasmid Preparation, Sequencing, Software

Journal: Materials Today Bio

Article Title: A novel tropoelastin-based resorbable surgical mesh for pelvic organ prolapse repair

doi: 10.1016/j.mtbio.2020.100081

Figure Lengend Snippet: Yarn structure. SEM micrographs of (a) 75:25, (b) 50:50, (c) 25:75 and (d) 0:100 tropoelastin:PCL electrospun yarns. Measurements of (e) yarn width, (f) fiber width, (g) fiber angle. Data show the mean ± standard deviation. For each group n = 3.

Article Snippet: Recombinant human tropoelastin (corresponding to amino acid residues 27–724 of GenBank entry AAC98394 ( https://www.ncbi.nlm.nih.gov/protein/AAC98394 ) isoform SHELΔ26A) was obtained from Elastagen.

Techniques: Standard Deviation

Journal: Materials Today Bio

Article Title: A novel tropoelastin-based resorbable surgical mesh for pelvic organ prolapse repair

doi: 10.1016/j.mtbio.2020.100081

Figure Lengend Snippet: Average tropoelastin:PCL yarn lengths using adjusted funnel collector speed and rotating winder speed.

Article Snippet: Recombinant human tropoelastin (corresponding to amino acid residues 27–724 of GenBank entry AAC98394 ( https://www.ncbi.nlm.nih.gov/protein/AAC98394 ) isoform SHELΔ26A) was obtained from Elastagen.

Techniques:

Journal: Materials Today Bio

Article Title: A novel tropoelastin-based resorbable surgical mesh for pelvic organ prolapse repair

doi: 10.1016/j.mtbio.2020.100081

Figure Lengend Snippet: Yarn composition. (a) Comparison FTIR-ATR offset spectra of tropoelastin:PCL electrospun yarns and pure tropoelastin. Representative FTIR-ATR spectra from 1950 to 1350 cm −1 . (b) FTIR-ATR spectral peak height of Amide I band of tropoelastin:PCL electrospun yarns. (c) Spectral peak height of carbonyl group band of tropoelastin:PCL electrospun yarns. Data show the mean ± standard deviation, for each group n = 3.

Article Snippet: Recombinant human tropoelastin (corresponding to amino acid residues 27–724 of GenBank entry AAC98394 ( https://www.ncbi.nlm.nih.gov/protein/AAC98394 ) isoform SHELΔ26A) was obtained from Elastagen.

Techniques: Comparison, Standard Deviation

Journal: Materials Today Bio

Article Title: A novel tropoelastin-based resorbable surgical mesh for pelvic organ prolapse repair

doi: 10.1016/j.mtbio.2020.100081

Figure Lengend Snippet: Effect of immersion under aqueous conditions on yarns. (a) SEM micrographs of tropoelastin:PCL electrospun yarns before and after water treatment for 24 h at 37 °C. (b) SDS-PAGE analysis of protein released from tropoelastin:PCL electrospun yarns after ethanol treatment and incubation in PBS at 37 °C for 1 (D1) or 7 (D7) days. TE - tropoelastin monomer, M12 - Mark12 protein standards. (c) Quantitative analysis of protein released from tropoelastin:PCL electrospun yarns after ethanol treatment and incubation in PBS at 37 °C for 1, 3, 5 and 7 days. Data are expressed as percent of total yarn mass (2 mg) and show the mean ± standard deviation, for each group n = 3.

Article Snippet: Recombinant human tropoelastin (corresponding to amino acid residues 27–724 of GenBank entry AAC98394 ( https://www.ncbi.nlm.nih.gov/protein/AAC98394 ) isoform SHELΔ26A) was obtained from Elastagen.

Techniques: SDS Page, Incubation, Standard Deviation

Journal: Materials Today Bio

Article Title: A novel tropoelastin-based resorbable surgical mesh for pelvic organ prolapse repair

doi: 10.1016/j.mtbio.2020.100081

Figure Lengend Snippet: 50:50 tropoelastin:PCL yarn and mesh. Capacity for electrospinning of (a) long continuous strands of 50:50 yarns allows for (b) woven mesh fabrication. Young's modulus (c), ultimate tensile strength (d) and elongation at break (e) of 50:50 yarns and meshes hydrated in PBS at 37 °C. Cyclic tensile testing (f) of 50:50 meshes indicating hysteresis and non-permanent deformation (n = 4). (g) Confocal images of human dermal fibroblasts cultured on 50:50 yarns after 7 days incubation in cell culture media at 37 °C. Cells were stained with ActinRed (red) to view F-Actin, and TO-PRO 3 iodide (cyan) to image nuclei, followed by merged images. (h) Fibroblast proliferation on 50:50 meshes over seven days (n = 3). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Article Snippet: Recombinant human tropoelastin (corresponding to amino acid residues 27–724 of GenBank entry AAC98394 ( https://www.ncbi.nlm.nih.gov/protein/AAC98394 ) isoform SHELΔ26A) was obtained from Elastagen.

Techniques: Cell Culture, Incubation, Staining

Journal: Materials Today Bio

Article Title: A novel tropoelastin-based resorbable surgical mesh for pelvic organ prolapse repair

doi: 10.1016/j.mtbio.2020.100081

Figure Lengend Snippet: Histology of tropoelastin:PCL mesh after 4 weeks implantation in the ovine vagina. H&E (a) showing panoramic view of 50:50 tropoelastin:PCL mesh mainly between the lamina propria and muscularis (black arrows) and in the muscularis (blue arrows), compared with (b) incision control. Higher power images show the (c, d) mesh and (e, f) incision control, respectively. Collagen staining by Gomori (blue) (g–j) and Sirius Red (red) (k–n) show collagen around mesh filaments (arrows) and in ECM. VVG staining (o–r) show a few black elastin fibers in the tissue and around the tropoelastin of the mesh filament surface (arrows). LP, lamina propria. Representative images n = 1 each of mesh implanted and incision control ewes. Scale bars: (a–b) 2 mm, (c–r) 200 μm. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Article Snippet: Recombinant human tropoelastin (corresponding to amino acid residues 27–724 of GenBank entry AAC98394 ( https://www.ncbi.nlm.nih.gov/protein/AAC98394 ) isoform SHELΔ26A) was obtained from Elastagen.

Techniques: Control, Staining

Journal: Materials Today Bio

Article Title: A novel tropoelastin-based resorbable surgical mesh for pelvic organ prolapse repair

doi: 10.1016/j.mtbio.2020.100081

Figure Lengend Snippet: Immunofluorescence images showing deposited collagen III (green) in explanted ovine vaginal tissue after 30 days (a) near the incision site and (b) around filaments of the tropoelastin:PCL mesh, in contrast to the (c) isotype control. (d, e) Birefringence of Sirius Red-stained vaginal tissue shows mature (red) and immature collagen (green) after 30 days of implanted tropoelastin:PCL mesh in ovine vagina. SEM images of explanted ovine vaginal tissue with (f) tropoelastin:PCL mesh show (g) integrity of the yarn structure and (h) integration (white dotted box) of mesh (#) with host tissue (∗) after 30 days. Dotted line indicates epithelial lamina propria border. Key: e, epithelium; t, tropoelastin:PCL. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Article Snippet: Recombinant human tropoelastin (corresponding to amino acid residues 27–724 of GenBank entry AAC98394 ( https://www.ncbi.nlm.nih.gov/protein/AAC98394 ) isoform SHELΔ26A) was obtained from Elastagen.

Techniques: Immunofluorescence, Control, Staining

Journal: Materials Today Bio

Article Title: A novel tropoelastin-based resorbable surgical mesh for pelvic organ prolapse repair

doi: 10.1016/j.mtbio.2020.100081

Figure Lengend Snippet: Analysis of foreign body response to tropoelastin:PCL mesh implanted in an ovine vaginal surgery model of POP. Immunohistochemistry for (a) CD45 (b) HLA-DR (c) CD206 and (d) CD34 stained positive cells in brown in the epithelium and lamina propria of a tropoelastin:PCL explant, in comparison to (e–h) incision control ovine vaginal tissues. Immunofluorescence shows colocalization of CD45 + leukocytes (green) and CD206 + M2 macrophages (red; merge = yellow) at the (i) tropoelastin:PCL filament tissue interface. In tissue more distant to the filaments, CD45 + leukocytes (green in merge panel) were either M1 inflammatory or M0 uncommitted macrophages. (j) CD45 + leukocytes (green) colocalize with CD206 + M2 macrophages (red) in incision control ovine vaginal tissue. Representative images of n = 1 mesh implanted and n = 1 incision control ewe. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.).

Article Snippet: Recombinant human tropoelastin (corresponding to amino acid residues 27–724 of GenBank entry AAC98394 ( https://www.ncbi.nlm.nih.gov/protein/AAC98394 ) isoform SHELΔ26A) was obtained from Elastagen.

Techniques: Immunohistochemistry, Staining, Comparison, Control, Immunofluorescence